HomeMy WebLinkAboutC-3483 - Water Quality Studies - Fecal coliform TMDL Study0 0 a-3 q3 3
PROFESSIONAL SERVICES AGREEMENT
THIS AGREEMENT, entered into thisa8 t" day of May 2002, by and between CITY OF
NEWPORT BEACH, a Municipal Corporation (hereinafter referred to as "City "), and The
Regents of the University of California, on behalf of its Irvine campus (hereinafter
referred to as "Consultant "), is made with reference to the following:
RECITALS
A. City is a municipal corporation duly organized and validly existing under
the laws of the State of California with the power to carry on its business
as it is now being conducted under the statutes of the State of California
and the Charter of City.
B. City desires to engage Consultant to provide staff services for
Bacterial/Viral Source Tracking of Tributaries to Newport Bay ('Research
Project').
C. The principal investigator of Consultant is, for purpose of this Research
Project, Dr. Sunny Jiang ( "Principal Investigator ").
D. City has reviewed the previous experience and evaluated the expertise of
Consultant and desires to contract with Consultant under the terms and
conditions provided in this Agreement.
NOW, THEREFORE, it is mutually agreed by and between the undersigned
Parties as follows:
1. TERM
The term of this Agreement shall commence on the 28'h day of May 2002, and
shall terminate on the 27th day of May 2003, unless terminated earlier as set forth
herein.
2. SERVICES TO BE PERFORMED
Consultant shall diligently perform all the duties set forth in the Scope of
Services, attached as Exhibit "A" and incorporated herein by reference.
11
• 0
3. COMPENSATION TO CONSULTANT
City shall pay Consultant for the services in accordance with the provisions of
this Section and the Research Project budget, attached as Exhibit "B" and incorporated
herein by reference. No budget changes shall be made during the term of this
Agreement without prior written approval of City. Consultant's compensation for all
work performed in accordance with this Agreement shall not exceed the total contract
price of one hundred sixty six thousand, nine hundred and twenty dollars ($166,920.00).
3.1 Consultant shall maintain accounting records of its billings which includes
the name of the employee, type of work performed, times and dates of all work which is
billed on an hourly basis and all approved incidental expenses including testing
supplies.
3.2 Consultant shall submit monthly invoices to City payable by City within
thirty (30) days of receipt of invoice subject to the approval of City.
3.3 Consultant shall not receive any compensation for extra work without prior
written authorization of City.
3.4 City shall reimburse Consultant only for those costs or expenses which
have been specifically approved in this Agreement, or specifically approved in advance
by City. Such cost shall be limited and shall include nothing more than the following
costs incurred by Consultant:
A. The actual costs of subconsultants for performance of any of the services
which Consultant agrees to render pursuant to this Agreement which have
been approved in advance by City and awarded in accordance with the
terms and conditions of this Agreement.
B. Approved computer data processing and reproduction charges.
C. Actual costs and /or other costs and /or payments specifically authorized in
advance in writing and incurred by Consultant in the performance of this
Agreement.
3.5 Notwithstanding any other paragraph or provision of this Agreement,
beginning on the effective date of this Agreement, City may withhold payment of ten
percent (10 %) of each approved payment as approved retention until all services under
this Agreement have been substantially completed.
4. STANDARD OF CARE
4.1 All of the services shall be performed by Consultant or under Consultant's
supervision. Consultant represents that it possesses the professional and technical
2
• 0
personnel required to perform the services required by this Agreement, and that it will
perform all services in a manner commensurate with the university's professional
standards. All services shall be performed by qualified and experienced personnel who
are not employed by City nor have any contractual relationship with City. Consultant
represents and warrants to City that it has or shall obtain all licenses, permits,
qualifications and approvals required of its profession. Consultant further represents
and warrants that it shall keep in effect all such licenses, permits and other approvals
during the term of this Agreement.
4.2 Consultant shall not be responsible for delay, nor shall Consultant be
responsible for damages or be in default or deemed to be in default by reason of strikes,
lockouts, accidents, or acts of God, or the failure of City to furnish timely information or
to approve or disapprove Consultant's work promptly, or delay or faulty performance by
City, contractors, or governmental agencies, or any other delays beyond Consultant's
control or without Consultant's fault.
5. INDEPENDENT PARTIES
City retains Consultant on an independent contractor basis and Consultant is not
an employee of City. The manner and means of conducting the work are under the
control of Consultant, except to the extent they are limited by statute, rule or regulation
and the expressed terms of this Agreement. Nothing in this Agreement shall be
deemed to constitute Consultant or any of Consultant's employees or agents, to be the
agents or employees of City. Consultant shall have the responsibility for and control
over the details in means of performing the work provided that Consultant is in
compliance with the terms of this Agreement. Anything in this Agreement which may
appear to give City the right to direct Consultant as to the details of the performance of
the services or to exercise a measure of control over Consultant shall mean that
Consultant shall follow the desires of City only with respect to the results of the services.
6. COOPERATION
Consultant agrees to work closely and cooperate fully with Dave Kiff, Assistant
City Manager, the City's designated Research Project administrator ( "Project
Administrator"), and any other agencies which may have jurisdiction or interest in the
work to be performed. City agrees to cooperate with the Consultant on the Research
Project.
7. PROJECT MANAGER
Consultant shall assign responsibility for the Research Project to a Principal
Investigator, who shall coordinate all phases of Consultant's efforts on the Research
Project. The Principal Investigator shall be available to City at all reasonable times
during the Research Project term. Consultant has designated Dr. Sunny Jiang to be its
3
• f
Principal Investigator. Consultant shall not bill any personnel to the Research Project
other than those personnel identified in Exhibit "B ", whether or not considered to be key
personnel, without City's prior written approval by name and specific salary rate.
Consultant shall not remove or reassign the Principal Investigator designated in this
Section or assign any new or replacement Principal Investigator to the Research Project
without the prior written consent of City. City's approval shall not be unreasonably
withheld with respect to replacement of the Principal Investigator.
Consultant warrants that it will continuously furnish the necessary personnel to
complete the Research Project on a timely basis as contemplated by this Agreement.
8. TIME OF PERFORMANCE
Time is of the essence in the performance of the services under this Agreement
and the services shall be performed by Consultant in accordance with Exhibit A. The
failure by Consultant to strictly adhere to the schedule may result in termination of this
Agreement by City. Notwithstanding the foregoing, Consultant shall not be responsible
for delays which are due to causes beyond Consultant's reasonable control. However,
in the case of any such delay in the services to be provided for the Research Project,
each party hereby agrees to provide notice to the other party so that all delays can be
addressed.
8.1 Consultant shall submit all requests for extensions of time for performance
in writing to the Project Administrator not later than ten (10) calendar days after the start
of the condition which purportedly causes a delay, and not later than the date upon
which performance is due. The Project Administrator shall review all such requests and
may grant reasonable time extensions for unforeseeable delays, which are beyond
Consultant's control.
8.2 For all time periods not specifically set forth herein, Consultant shall
respond in the most expedient and appropriate manner under the circumstances, by
either telephone, fax, e-mail, hand delivery or mail.
9. CITY POLICY
Consultant will discuss and review all matters relating to policy and project
direction with the Project Administrator in advance of all critical decision points in order
to ensure that the Research Project proceeds in a manner consistent with City goals
and policies.
0
0
10. CONFORMANCE TO APPLICABLE REQUIREMENT
All work prepared by Consultant shall conform to applicable city, county, state
and federal law, regulations and permit requirements and be subject to approval of the
Project Administrator and City.
11. PROGRESS
Consultant is responsible to keep the Project Administrator and /or his /her duly
authorized designee informed on a regular basis regarding the status and progress of
the work, activities performed and planned, and any meetings that have been scheduled
or are desired.
12. HOLD HARMLESS
Consultant shall indemnify, defend, save and hold harmless City, its City Council,
boards and commissions, officers and employees from and against any and all loss,
damages, liability, claims, allegations of liability, suits, costs and expenses for damages
of any nature whatsoever, including, but not limited to, bodily injury, death, personal
injury, property damages, or any other claims arising from any and all acts or omissions
of Consultant, its employees, agents or subcontractors in the performance of services or
work conducted or performed pursuant to this Agreement, but only in proportion to and to
the extent such loss, damages, liability, claims, allegations of liability, suits, costs and
expenses for damages are caused by or result from the negligent or intentional acts or
omissions of Consultant, its officers, agents, or employees.
City shall indemnify, defend, save and hold harmless Consultant, its trustees,
boards and commissions, officers and employees from and against any and all loss,
damages, liability, claims, allegations of liability, suits, costs and expenses for damages
of any nature whatsoever, including, but not limited to, bodily injury, death, personal
injury, property damages, or any other claims arising from any and all acts or omissions
of City, its employees, agents or subcontractors in the performance of services or work
conducted or performed pursuant to this Agreement, but only in proportion to and to the
extent such loss, damages, liability, claims, allegations of liability, suits, costs and
expenses for damages are caused by or result from the negligent or intentional acts or
omissions of City, its officers, agents, or employees.
Nothing in this indemnity shall be construed as authorizing, any award of attorneys' fees
in any action on or to enforce the terms of this Agreement.
E
0 0
13. INSURANCE
Without limiting consultant's indemnification of City, and prior to commencement
of work, Consultant shall obtain and provide and maintain at its own expense during the
term of this Agreement self- insurance or policy or policies of liability insurance of the
type and amounts described below and satisfactory to City. Certification of all required
policies shall be signed by a person authorized by that insurer to bind coverage on its
behalf and must be filed with City prior to exercising any right or performing any work
pursuant to this Agreement. Except workers compensation, all insurance policies shall
add City, its elected officials, officers, agents, representatives and employees as
additional insured for all liability arising from Consultant's services as described herein.
All insurance policies shall be issued by an insurance company currently
authorized by the Insurance Commissioner to transact business of insurance in the
State of California, with an assigned policyholders' Rating of A (or higher) and Financial
Size Category Class VII (or larger) in accordance with the latest edition of Bests Key
Rating Guide: unless otherwise approved by the City Risk Manager.
A. Worker's compensation insurance covering all employees and principals
of Consultant, per the laws of the State of California.
B. Commercial general liability insurance covering third party liability risks,
including without limitation, contractual liability, in a minimum amount of $1
million combined single limit per occurrence for bodily injury, personal
injury and property damage. If commercial general liability insurance or
other form with a general aggregate is used, either the general aggregate
shall apply separately to this Research Project, or the general aggregate
limit shall be twice the occurrence limit.
C. Commercial auto liability and property insurance covering any owned and
rented vehicles of Consultant in a minimum amount of $1 million combined
single limit per accident for bodily injury and property damage.
Said policy or policies shall be endorsed to state that coverage shall not be
canceled by either party, except after thirty (30) days' prior notice has been given in
writing to City. Consultant shall give City prompt and timely notice of claim made or suit
instituted arising out of Consultant's operation hereunder. Consultant shall also procure
and maintain, at its own cost and expense, any additional kinds of insurance, which in
its own judgment may be necessary for its proper protection and prosecution of the
work.
Consultant agrees that, in the event of loss due to any of the perils for which it
has agreed to provide comprehensive general and automotive liability insurance,
Consultant shall look solely to its insurance for recovery. Consultant hereby grants to
City, on behalf of any insurer providing comprehensive general and automotive liability
insurance to either Consultant or City with respect to the services of Consultant herein,
2
• r
a waiver of any right of subrogation which any such insurer of said Consultant may
acquire against City by virtue of the payment of any loss under such insurance.
14. PROHIBITION AGAINST TRANSFERS
Consultant shall not assign, sublease, hypothecate or transfer this Agreement or
any for the services to be performed under this Agreement, directly or indirectly, by
operation of law or otherwise without prior written consent of City. Any attempt to do so
without consent of City shall be null and void.
15. OWNERSHIP OF DOCUMENTS
Each and every report, draft, work product, map, record and other document
reproduced, prepared or caused to be prepared by Consultant pursuant to or in
connection with this Agreement and delivered to City shall be the exclusive property of
City.
Documents, including drawings and specifications, prepared by Consultant
pursuant to this Agreement are not intended or represented to be suitable for reuse by
City or others on any other project. Any use of completed documents for other projects
and any use of incomplete documents without specific written authorization from
Consultant will be at City's sole risk and without liability to Consultant. Further, any and
all liability arising out of changes made to Consultant's deliverables under this
Agreement by City or persons other than Consultant is waived against Consultant and
City assumes full responsibility for such changes unless City has given Consultant prior
notice and has received from Consultant written consent for such changes.
Consultant shall, at such time and in such form as City may require, furnish
reports concerning the status of services required under this Agreement.
16. CONFIDENTIALITY
Because the City deems the Scope of Services outlined in Attachment A to be of
benefit to a wide variety of constituencies, the City and its Consultant apply no specific
confidentiality limitations on any information which results from the services in this
Agreement. Both parties reserve the right to retain any information as confidential if
agreed to by both parties.
17. ADMINISTRATION
This Agreement will be administered by the City Manager's Department. Dave
Kiff, Assistant City Manager, shall be considered the Project Administrator and shall
have the authority to act for City under this Agreement. The Assistant City Manager or
0
L]
his authorized representative shall represent City in all matters pertaining to the
services to be rendered pursuant to this Agreement.
18. RECORDS
Consultant shall keep records and invoices in connection with the work to be
performed under this Agreement. Consultant shall maintain complete and accurate
records with respect to the costs incurred under this Agreement. All such records shall
be clearly identifiable. Consultant shall allow a representative of City to examine, audit
and make transcripts or copies of such records during normal business hours.
Consultant shall allow inspection of all work, data, documents, proceedings and
activities related to the Agreement for a period of three (3) years from the date of final
payment under this Agreement.
19. WITHHOLDINGS
City may withhold payment of any disputed sums until satisfaction of the dispute
with respect to such payment. Such withholding shall not be deemed to constitute a
failure to pay according to the terms of this Agreement. Consultant shall not discontinue
work as a result of such withholding. Consultant shall have an immediate right to
appeal to the City Manager or his designee with respect to such disputed sums.
Consultant shall be entitled to receive interest on any withheld sums at the rate of seven
percent (7 %) per annum from the date of withholding of any amounts found to have
been improperly withheld.
20. CITY'S RIGHT TO EMPLOY OTHER CONSULTANTS
City reserves the right to employ other consultants in connection with the
Research Project.
21. CONFLICTS OF INTEREST
A. The Consultant or its employees may be subject to the provisions of the
California Political Reform Act of 1974 (the "Act "), which (1) requires such
persons to disclose financial interest that may foreseeably be materially
affected by the work performed under this Agreement, and (2) prohibits
such persons from making, or participating in making decisions that will
foreseeably financially affect such interest.
B. If subject to the Act, Consultant shall conform to all requirements of the
Act. Failure to do so constitutes a material breach and is grounds for
termination of this Agreement by City. Consultant shall indemnify and
A
0
hold harmless City for any and all claims for damages resulting from
Consultant's violation of this Section.
22. SUBCONSULTANT AND ASSIGNMENT
Except as specifically authorized under this Agreement, the services included in
this Agreement shall not be assigned, transferred, contracted or subcontracted without
prior written approval of City.
23. NOTICES
All notices, demands, requests or approvals to be given under this Agreement
shall be given in writing and conclusively shall be deemed served when delivered
personally or on the third business day after the deposit thereof in the United States
mail, postage prepaid, first class mail, addressed as hereinafter provided.
All notices, demands, requests or approvals from Consultant to City shall be
addressed to City at:
City of Newport Beach
City Manager's Office
3300 Newport Boulevard
P. 0. Box 1768
Newport Beach, CA, 92658 -8915
949/644- 3002(phone)
949/644 -3020 (fax)
All notices, demands, requests or approvals from City to Consultant shall be
addressed to Consultant at:
Attention: Doug Bickham
Contracts Officer
Sponsored Projects Administration
University of California, Irvine
160 Administration Building
Irvine, CA 92697- 1875
(949) 824- 2644 (phone)
(949) 824- 2094 (fax)
24. TERMINATION
In the event either party hereto fails or refuses to perform any of the provisions
hereof at the time and in the manner required hereunder, that party shall be deemed in
0
0
default in the performance of this Agreement. If such default is not cured within a period
of two (2) days, or if more than two (2) days are reasonably required to cure the default
and the defaulting party fails to give adequate assurance of due performance within two
(2) days after receipt of written notice of default, specifying the nature of such default
and the steps necessary to cure such default, the nondefaulting party may terminate the
Agreement forthwith by giving to the defaulting party written notice thereof.
City or Consultant shall have the option, at its sole discretion and without cause,
of terminating this Agreement by giving seven (7) days' prior written notice to the other
party as provided herein. Upon termination of this Agreement, City shall pay to the
Consultant that portion of compensation specified in this Agreement that is earned and
unpaid prior to the effective date of termination.
25. COMPLIANCES
Consultant shall comply with all laws, state or federal and all ordinances, rules
and regulations enacted or issued by City.
26. WAIVER
A waiver by either party of any breach, of any term, covenant or condition
contained herein shall not be deemed to be a waiver of any subsequent breach of the
same or any other term, covenant or condition contained herein, whether of the same or
a different character.
27. INTEGRATED CONTRACT
This Agreement represents the full and complete understanding of every kind or
nature whatsoever between the Parties hereto, and all preliminary negotiations and
agreements of whatsoever kind or nature are merged herein. No verbal agreement or
implied covenant shall be held to vary the provisions herein. Any modification of this
Agreement will be effective only by written execution signed by both City and
Consultant.
IN WITNESS WHEREOF, the Parties have caused this Agreement to be
executed on the day and year first written above.
10
0
AS TO FORM:
Robert Burnham
City Attorney
for the City of Newport Beach
ATTEST:
' . riK,
City Clerk
0
CITY OF NEWPORT BEACH
A Municipal Corporation
By:
Tod W. Ridgew
Mayor n a
for the City of Newport Beach
CONSULTANT
SARAJUDD&ER
CONTRACTS OF)=WRegents of
the University of California
11
Sunny Jiang
0
Scope of Work
05/24/2002
Determining the Relationships Between Fecal Indicators
and Human Pathogenic Viruses in Newport Bay Watershed
Phase II
Background and Objectives:
The microbial quality of water is a prime public health concern in today's world. It is
estimated that the risk of becoming ill as a result of microbial contamination of food and water is
100,000 times greater than the risk from pesticide contamination (WHO 1993). To protect public
health, the World Health Organization and the U.S. Environmental Protection Agency have
established microbial pollution indicator standards and recommended routine monitoring of
water for fecal bacterial indicators (Dufour, 1984, U.S. EPA 1986,1994, WHO 1993).
Coastal recreational water quality standards in California, and throughout most of the
world, are based on the concentration of total coliform, fecal coliform, and enterococcus groups
of indicator bacteria (Bartram and Rees 2000). However, the adequacy of current water quality
standards to indicate the presence or absence of human pathogens is still questionable. For
example, human viruses are more resistant to sewage treatment processes and environmental
conditions than bacterial indicators and therefore may pose a substantial threat. It is now
recognized that the absence, or a low concentration, of indicator organisms in water may not
adequately reflect the absence of human viruses. Waterborne infectious viruses are suspected to
be more important than current knowledge suggests because viral diseases are hard to identify by
current diagnostic techniques. While the causative agent of nearly 50% of all acute
gastrointestinal illnesses cannot be identified (Center for Disease Control, 1988, 1990, 1991,
1993) most of these illnesses are suspected to be caused by viruses. Therefore, viral quality of
recreational coastal water is of particular importance and a rising public health concern.
Newport Bay, California is an important estuarine system in Southern California.
Tourists worldwide visit this area for boating, kayaking, sailing, swimming and other water
recreational activities. To protect public health and the beneficial use of this valuable resource,
the State Water Quality Control Board requires strategies to be developed and stepwise
implemented to improve Newport Bay water quality to meet recreational standards (REC -1) by
the year 2014. With the goal of understanding the relationship between fecal indicator bacterial
concentrations and human pathogenic viral loads in this watershed, the specific objectives of this
study are the following:
1. To statistically determine the relationships between enteric viruses and fecal indicators
(total coliform, fecal coliform, enterococcus and F- coliphage) in the watershed;
2. To determine the presence and distribution of F- specific coliphage and enteric viruses in
various locations in Newport Bay and its tributaries using culture enrichment and
polymerase chain reaction (PCR) analysis, respectively;
3. To investigate the viral infectivity by combining PCR with tissue culture analysis
(integrated PCR tissue culture assay).
i
Sunny Jiang
Project Approach
05/24/2002
Results from the phase I & N Newport Bay water quality investigation conducted during
the summer of 2000 and 2001 indicated that the occurrence of enteroviruses did not statistically
correlate with the abundance of total coliform, fecal coliform and enterococcus. However, in all
cases when there was a presence of enterovirus, the enterococcus number was always greater
than the current AB411 standards (100 CFU /100m1). Only a few locations around the Bay were
sampled repetitively to produce a statistically valid analysis of the relationship between viruses
and indicators. This proposed study will expand sampling locations and frequencies for human
viral testing, guided by a desired statistical sensitivity and power. In addition, more than one
virus will be included in our detection effort because the presence of viral contamination in the
watershed may shift with the human disease load and the populations harboring the disease
(either symptomatic or asympotomatic) in a local community.
Sampling Plans
The proposed sampling locations and frequencies are listed in Table 1. A total of 15
locations around the Newport Bay will be sampled 8 times between May 22, 2002 and
September 24, 2002.
Three to five liters of water samples will be collected from each site and split for
detection of fecal bacterial indicators, enteric viruses and coliphage. Table 1. shows the proposed
sampling schedule and parameters that will be determined at each location. All water samples for
viral testing will be collected between 6 to 9 am in the morning and processed within 4 -6 hours
of collection. Simultaneously, the temperature and salinity of the water will also be measured in
situ to provide background information on basic environmental conditions. The tidal cycles will
be noted at the stage of data analysis. All data collected will be logged into a database on the
same day of the sample collection.
Detection of Enteric Viruses
A minimum of 500m1 of water from each site will be concentrated using a Centriplus
ultrafiltration system (Millipore Inc.) to a final volume of —500 µl. This 1000 fold concentration
factor will allow detection of viruses at a concentration greater than 200 genomes per liter of
water. The final concentrates will be slit and stored frozen until analyzed by PCR and tissue
culture.
Viral nucleic acid extraction and purification will follow the method originally developed
by Boom et al. (1990) with minor modifications. This method uses guanidinium thiocyanate
(GuSCN) with Triton X -100 to lyse viral particles and silica beads to absorb nucleic acid,
allowing effective purification of DNA and RNA at the same time. In brief, 50 µl of viral
concentrate are lyted by 900 µl of GuSCN lysis buffer at room temperature for 10 min. Then 40
µl of silica particles are added and nucleic acids absorbed at room temperature for 10 min with
gentle shaking. Silica beads are pelleted, washed and dried. The nucleic acid will is then eluted
from the beads using 50 µl TE buffer at a temperature of 56 °C. The purified nucleic acid will be
used for detection of human viruses by PCR or RT -PCR as described below. This method has
been shown to be effective at purification of viral nucleic acid from seawater concentrates, river
•
Sunny Jiang
0
05/24/2002
water and sewage effluent. Alternatively, we will use commercial RNA and DNA purification kit
for extraction.
Primers for specific amplification of the target viral genomes are shown in Table 2. The
procedure for RT -PCR of enterovirus will follow the protocol developed by Tsai et al. (1993)
with a modification of the total reaction volume. Amplification products will be further
confirmed by probing with internal oligonucleotide probes after southern transfer of DNA.
Probing will also increase the detection limit of the PCR amplification product. For adenovirus
detection, a nested PCR protocol will be used as previously described by Pina et al. (1998). This
procedure has been successfully used in my laboratory for detection of viruses in coastal waters.
Determine the Viral Infectivity by Integrated Cell Culture PCR
To compare viral infectivity with PCR results, the frozen concentrate will be used for
integrated cell culture PCR as described by Ballaster et al. (2000). This portion of the study will
be conducted during the second year of the project once initial PCR screening has been
completed. Final results from these analyses will be integrated with the results on the presence of
human viruses by direct PCR, standard fecal indicators, coliphage and basic environmental
parameters.
Quantification of F- specific Coliphage by Culture Enrichment
Five -tube enrichment will be used to determine the most probable number (MPN) of the
phage. For MPN determination, five 100 -m1 water samples from each site were amended with 5
ml sterile 11 x TSB medium, 1 ml E. coli host and antibiotics. Negative controls will contain five
tubes of 100 -m1 sterile DI water amended with nutrient medium, E. coli host and antibiotic as in
regular sample assay. The enrichment cultures will be incubated at 37°C for 24 hours before spot
testing for the presence of F- specific coliphage.
For replicate spot testing, 1 ml of log phase E. coli host will be mixed with top agar and
overlayed onto TSB agar plates containing antibiotics to form an even bacterial lawn. Two
microliters of each enrichment culture was spotted onto the freshly prepared bacterial lawn.
Plates are incubated at 37 °C for 8 to 16 hours. Clearing spots are scored and the MPN calculated
using Thomas' formula (Clesceri et al. 1998).
Statistical Analysis to Determine the Relationship Between Human Viruses and Fecal
Indicators
Statistical analysis of the entire data set will be performed during the second project year when
all tests for all samples are completed. Both linear regression analysis and multiple regression
analysis will be conducted using the data set. The concentration of fecal indicators, human
viruses and coliphage may be natural log transformed to achieve normal distribution. Human
viruses will be used as the dependent variable and all other measured factors will be used as
independent variables in the linear regression analysis. The relationship between independent
variables will be examined by analysis of variance (ANOVA) to ruleout of the possibility of
covariance. Other statistical analysis may also be used if considered necessary when data
0
Sunny Jiang
05/24/2002
becomes available. All statistical analyses will be performed using the SAS or SPSS software
packages (SPSS Inc. Chicago, IL).
Table 1. Sampling Sites and Schedule for Summer 2002 Study
Sampling Sites
Fecal indicator bacteria "hot spots'
1 Santa Ana Delhi Channel at Mesa
2 Santa Ana Delhi Channel at University
3 San Diego Creek at Campus
4 Lower Newport Bay at 43rd Street
5 Big Canyon Wash
High recreational use sites
6 North Star Beach
7 Newport Dunes North ( @Bridge)
8 Newport Dunes Inside Roped Swimming Area
9 Bayshores Beach
10 Balboa Yacht Basin
11 10th Strett Beach or 19th Street Beach
12 Garnet Avenue Beach (on Balboa Island)
13 Harbor Patrol Beach
14 Rocky Point Beach
15 Newport Dunes Outside Roped Swimming Area
Sampling Dates
May 22, 2002
May 28, 2002
June 10, 2002
July 6, 2002
July 22, 2002
August 7, 2002
September 3, 2002
September 22, 2002
Assay to be performed on each sample
Environmental Parameters
Temperature
Salinity
Conductivity
Fecal indicators
Total coliform, Fecal coliform, Enterococcus
F- specific coliphage- enrichment
Total 15 samples per day
Special Notes
First Day after Memorial Day
Saturday- During July 4th long weekend
First Day after labor day weekend
Sunday
Total 8 times per summer
El
0 •
Sunny Jiang 05/24/2002
Enteric viruses by PCR
viruses Inefectivity assay
Total number of samples 120
Note: Dr. Jiang may perform adenovirus detection tests using the same samples.
Table 2. PCR primers and probes for virus detection
Target Primer and probe sequences Amplicon and
viruses target
Pan- Upstream, 5'- CCTCCGGCCCTGAATG -3' 197 -bp highly
enterovirus Downstream, 5'- ACCGGATGGCCAATC -3' conserved 5'
Probe, 5'- TACTTTGGGTGTCCGTGTTTC -3' untranslated
region.
Adenovirus First upstream, 5'- GCCGCAGTGGTCTTACATGCACATC -3' 301 -bp Hexon
First downstream, 5'- CAGCACGCCGCGGATGTCAAAGT -3'
Nested upstream ,5' - GCCACCGAGACGTACTTCAGCCTG -3' 143 -bp Hexon
Nested downstream 5'-
TTGTACGAGTACGCGGTATCCTCGCGGTC-3'
5
Budget Justification for
human pathogenic viruses
A. PERSONNEL
"Itermining the relationship
in Newport Bay Watersbed ".
61�6a 6
betweenTecalindicators and
PI: Sunny Jiang will be in charge of the research work done on the Newport Bay
Project, located in the Newport Bay waters. She will devote 10% of her time during the
academic school year and summer to direct the sampling plan, sample analysis and
preparation of the final report. All salaries and wages were estimated using UCI's
academic and staff salary scales.
Postgraduate Researcher to be announced at a later date will be helping Dr. Jiang in
conducting her research and collecting samples of water from Newport Bay. He /She will
analyze the samples for the occurrence of human viruses by PCR and tissue cultures on
this project. The Postgraduate Researcher will devote 100% of its time during the
academic school year and summer.
Lab Assistant to be announced at a later date will help Dr. Jiang and the Post -Doc on
analyzing the samples collected for the presence of F- specific coliphage and other
environmental parameters. This person will work at a rate of 25% during the fiscal year.
Anticipated cost of living increases effective 10101102 are 2% for academic personnel
and staff. The fringe benefits are calculated at the composite rate of 17% for
Professor's and Post Graduate Researcher's during the academic school year. Lab
Assistant's fringe benefit rate is calculated at the composite rate of 5.2 %.
B. SUPPLIES
Material and Supplies the cost will cover particular materials and supplies such as;
molecular reagents, enzymes, microbiological media, tissue culture supplies and media,
disposable plastic ware, nylon membrane, automatic pipettes, and glassware. All costs are
based on previously purchased and presently used chemicals, reagents and supplies and on
catalogue prices.
C. Publication
Publication cost will cover any materials or supplies etc., that go along with publishing
information on the results founded during the research of microbial contamination of
food and water.
D. Facilities and Administrative
In accordance with the City of Newport Beach policy on research contracts, the indirect
costs have been limited to 15% on this proposal.
0 0
Detailed Budget Outline
Cost Category items
Period
5/01/024/30/04
Salaries and Wages
PI: Sunny Jiang, Ph.D. - 10% MOS 24
$
11,092
TBN, Postdoc PGR II - 100% Mos 24
$
68,944
TBN, Lab assistant II, Ste I - 25% Mos 24
$
9,988
Subtotoal Salaries
$
90,024
Fringe Benefits
PI: Sunny Jiang -17%
TBN, Postdoc PGR II -17%
TBN, Lab Assistant II, Step 1 -5.2%
Subtotal Fringe Benefits
$
$
$
$
1,885
11,720
519
14,124
Total salary and Benefits
$
104,148
Non-expendable Equipment Items
N/A
Materials/Supplies
$
40,000
Travel
N/A
Computing
N/A
Other Costs/Publication Costs
$
1,000
Total Direct Costs
$
145,148
Facilities and Administration Rate (overhead)
15.00% •145,145 = 21,772
$
21,772
TOTAL COSTS
$
166,920
Cost per Sample Direct Cost
112 Samples each@ 1296
Indirect
$194
$
Total Per
Sample Cost
1,490
0
0
ITEM 18
C -3{83
TO: Members of the Newport Beach City Council
FROM: Dave Kiff, Assistant City Manager
SUBJECT: Summer -Fall 2002 Water Quality Testing Contract: Newport Bay and
Tributaries to Newport Bay
RECOMMENDED Authorize the Mayor to execute a contract with the University of California in
ACTION: the amount of $166,920.00 using funds budgeted in the Capital Improvement
Program for this purpose (CIP Item #7251- C5100596).
BACKGROUND: While most of Newport Bays waters routinely show levels of bacteria well below
levels allowed by State law (AB 411, Wayne, 1997) for water contact recreational
activities like swimming and wading, several locations often show bacteria levels
higher than allowed by State law. These areas include:
MAY 2 8 2002
43rd Street Beach (Channel Place Park)
Arches Marina (PCH and Newport Boulevard)
Santa Ana/ Delhi Channel
San Diego Creek
Big Canyon Wash
— Newport Dunes
The Orange County Health Care Agency's Environmental Health Division
(HCA) tests these six areas and about 30 more (see the map within this staff
report) at least once a week. If the areas exceed AB 411 standards for total
coliform, fecal coliform, or enterococcus, the County directs that the waters be posted
as potentially unsafe for water contact recreation. A posting is separate from a
closure. Per AB 411, the latter occurs when HCA suspects or knows of a sewage
spill or leak. The sign on the left is a closure sign - the sign on the right is a
posting sign.
Beach Gosure
KEEP OUT
•
SEWAGE CONTAMINATED
WATER
neaca
WARNI NGt
✓.Cfl �LLmftA Nf �EGV[f➢
iAVISO!
fliMfCA tRtfiNttl KtW
IIRfEtttYRFRIYICyLt
39%
0
0
The three bacteria listed above are known as indicator bacteria, meaning that they
may indicate the presence of a human pathogen like a virus, The key word is may -
for we do not know with certainty whether or not a virus is always attached to or
near the indicator bacteria. Nor do we know the source of the indicator bacteria
- the bacteria may be present due to bird droppings, pet waste, garden fertilizer,
or other decomposing organic matter.
Determining the source of the bacteria is an expensive challenge, with differing
ways on how such sourcing can be done. These methods include:
• Genetic Fingerprinting. This methodology takes unknown bacteria from
the water, determines the bacteria's DNA pattern, and then attempts to
match that pattern to a pattern from bacteria from a known source.
• Antibiotic Resistance. This method takes unknown bacteria from the
water, determines how the bacteria reacts to up to eight common
antibiotics, and then attempts to match the reaction patterns with bacteria
from known sources.
OC HCA's Newport Bay Weekly Sampling Areas
Better than merely using indicator bacteria, the City has embarked upon a
limited testing program of actual viruses within Newport Bay. These tests are
expensive, costing more than $1,400 per test. In 2000, the City contracted for
L.
Santa Ana- Ihl Channel
v.m m.. B
Iegu
s Dr
I ne
ughn's'Launch
m. n..r... Ig Canyon Wu
Waal.
orlhAar Beac
sm..
• o-an
uwxbl
_ mama., nwv
�
y Dr. Pipe
rcx era.
•
hlne h
u
m share
arti -� u M,B^N
1h S.
w.0
Yac lub
1a1h a[h
..na r...
t eta[
x Ave.
arnet Are.
rand Canal
Saphire re.Aba �
arbor Palrel Beach
�
I T i
LLVVJJ
Alvarado
H. W.
+
Cow W W W�
mw ,w N St. Deac '• .
Raegy Pl. Beuh
Pacific Ocean
Better than merely using indicator bacteria, the City has embarked upon a
limited testing program of actual viruses within Newport Bay. These tests are
expensive, costing more than $1,400 per test. In 2000, the City contracted for
L.
0 •
viral testing with Dr. Rachel Noble of the Southern California Coastal Water
Research Project (SCCWR), a Westminster -based joint- powers agency set up to
do water quality research. Dr. Sunny Jiang of the University of California, Irvine,
joined Dr. Noble in these efforts.
Drs. Noble and Jiang tested the following areas for human enteric virus particles:
— 43zd Street Beach (Channel Place Park)
Arches Marina
Bayshore Beach
— Santa Ana Delhi Channel (near Mesa and near University)
— San Diego Creek (near Campus and near Michelson)
— Big Canyon Wash
Back Bay Drain/ East Side of Newport Dunes
During two distinct periods of testing last summer, Drs. Noble and Jiang's data
showed no detectable levels of human enteric viruses in any area EXCEPT the
Santa Ana Delhi Channel. Five of six tested samples from the Santa Ana Delhi
Channel tested positive for the presence of human enteric viruses. The City paid
for this testing using a grant from the State Water Resources Control Board.
Here is an update on Summer 2001 Study efforts (including some results) and a
description of our efforts for Summer -Fall 2002:
• Antibiotic Resistance Testing in West Newport. This joint OC Health Care
Agency -City effort attempts to determine the source of chronic bacteria
problems around Newport Island. Dr. Doug Moore of OC HCA and Dr.
Jody Harwood of the University of South Florida are coordinating the
antibiotic resistance analysis (underway) for bacteria sampled in September -
October 2001.
• Swimmer Contribution Study at Newport Dunes. hi late August 2001, we
conducted a series of tests to attempt to determine if there is a link between
swimmers and fecal coliform in a high -use swimming area. That data did
NOT show a link. This test will be repeated several times in Summer 2002 to
a level of statistical significance. A requirement of the Fecal Coliform TMDL.
OC CoastKeeper will collect the samples and the Orange County Sanitation
District (OCSD) will test the samples.
• Vessel Waste Study. A City- Regional Board effort will attempt to determine
the extent of illegal waste discharges from boaters into Newport Harbor.
This will be the first summer for this test protocol and will occur about five
times in Summer 2002. A requirement of the Fecal Coliform TMDL. OC
CoastKeeper will collect the samples and OCSD will test the samples.
• Baywide Bacteria and Virus Testing. In an attempt to determine if
contamination levels have changed since 2000 and 2001, the City and the
Regional Board will participate in an extensive study starting this month and
continuing through September 2002 that tests fifteen locations in the Bay and
in its tributaries for viruses, the three bacterial indicators, and f specific
coliphage. See the following chart for the testing locations. OC CoastKeeper
will collect the samples and Dr. Jiang and her lab crew will test the samples.
3
0 0
Sampling Locations far Baywide Viral,Bacterial Testing
Locations
# Samples/Site
Sample Size:
Time of Day:
# of Samples
SantaAna Delhi- Mesa
split
1 -looml 81 rarouoy
start: 0600 end: 1000
8100 ml, 8 carbuoys
SantaAna Delhi- University
split
1- 100m181 carbuoy
start: 0600 end: 1000
8100 ml, 8 carbuoys
San Diego Ck-Campus
split
1- 100m161 carbuoy
start: 0600 end: 1000
8 100 ml, 8 carbuoys
43rd Street
split
moom181 carbuoy
Stan: 0600 end: 1000
8100 ml, 8 carbuoys
Big Canyon Wash
split
1- 100m161 carbuoy
start: 0600 end: 1000
8100 ml, 8 carbuoys
Northstar Beach
split
1.100m181 carbuoy
start: 0600 end: 1000
8 100 ml, 8 carbuoys
Newport Dunes East-whale
Split
I 1- 100m18 1 carbuoy
start: 0600 end: 1000
8100 ml, 8 wrbwys
Newport Dunes Easto tside swim
split
1- 100m18 1 carbucy
start: 0600 end: 1000
8 100 ml, 8 carbuoys
Newport Dunes North
split
1- 100m18 1 ramuoy
start: 0600 end: 1000
8 100 ml, 8 carbuoys
Bayshore Beach
split
1 -100ml 81 carbuoy
start: 0600 end: 1000
8 100 ml, 8 carbuoys
Balboa Yacht Basin
split
1 -100ml a 1 carbuoy
start: 0600 end: 1000
8 100 ml, 8 carbuoys
10th St Beach
split
1 -100" & 1 carbuoy
start: 0600 end: 1000
8 100 ml, 8 carbuoys
Gamet Ave Beach
split
1- 100m18 1 carbuoy
start: 0600 end: 1000
8 100 ml, 8 carbuoys
Harbor Patrol Beach
split
1- 100m18 1 carbuoy
start : 0600 end: 1000
8100 ml, 8 carbuoys
Rocky Pt. Beach
split
1 -100ml 8 1 ran uoy
I start: 0600 end: 1000
1 8100 ml, 8 carbuoys
Expert Help - the TAG. A study Technical Advisory Group (TAG) oversees
these studies with me - the TAG includes:
• Linda Candelaria, Regional Board
• Stephanie Gasca, Regional Board
• Larry Honeybourne, OC HCA
• Dave Kiff, City of Newport Beach
• Monica Mazur, OC HCA
• Charlie McGee, Orange County Sanitation District
• Jack Skinner, Newport Beach resident
• Wanda Smith, Regional Board
Costs. The total cost for the TESTING component (Dr. Jiang's work) will be
$166,920.00, which is about $1,490 per test (for the Baywide virus testing). This
amount includes a 15% charge for overhead for UC, a significant reduction from
the 50% overhead charged last year. Dr. Jiang is the only person who does this
type of testing ( "RT -PCR ") locally, so I decided to propose this contract as a sole -
source contract.
The total cost of the SAMPLING component (OC CoastKeeper's work) is about
$29,000.00. This contract will not be before the Council because it can be
approved by the City Manager per the City Charter.
The $195,920.00 is budgeted in the City's FY 2001 -02 Capital Improvement
Program (CIP #7251- C5100596).
THIS AGENDA This Agenda Item authorizes the Mayor to execute a contract with the Regents of
ITEM: the University of California to perform baywide bacterial and viral sampling in
accordance with the obligations of the Fecal Coliform TMDL.
ATTACHMENT: Attachment A - Contract with the Regents of the University of California
q
COUNCIL AGENDA
N0. 8 5 -a8 -o�
• PROFESSIONAL SERVICES AGREEMENT
THIS AGREEMENT, entered into this _"' day of May 2002, by and between CITY OF
NEWPORT BEACH, a Municipal Corporation (hereinafter referred to as "City "), and The
Regents of the University of California, on behalf of its Irvine campus (hereinafter
referred to as "Consultant "), is made with reference to the following:
RECITALS
A. City is a municipal corporation duly organized and validly existing under
the laws of the State of California with the power to carry on its business
as it is now being conducted under the statutes of the State of California
and the Charter of City.
B. City desires to engage Consultant to provide staff services for
BacterialNiral Source Tracking of Tributaries to Newport Bay ( "Research
Project ").
C. The principal investigator of Consultant is, for purpose of this Research
Project, Dr. Sunny Jiang ( "Principal Investigator").
• D. City has reviewed the previous experience and evaluated the expertise of
Consultant and desires to contract with Consultant under the terms and
conditions provided in this Agreement.
•
NOW, THEREFORE, it is mutually agreed by and between the undersigned
Parties as follows:
1. TERM
The term of this Agreement shall commence on the 28th day of May 2002, and
shall terminate on the 27th day of May 2003, unless terminated earlier as set forth
herein.
2. SERVICES TO BE PERFORMED
Consultant shall diligently perform all the duties set forth in the Scope of
Services, attached as Exhibit "A" and incorporated herein by reference.
01
0
3. COMPENSATION TO CONSULTANT
0
City shall pay Consultant for the services in accordance with the provisions of
this Section and the Research Project budget, attached as Exhibit "B" and incorporated
herein by reference. No budget changes shall be made during the term of this
Agreement without prior written approval of City. Consultant's compensation for all
work performed in accordance with this Agreement shall not exceed the total contract
price of one hundred sixty six thousand, nine hundred and twenty dollars ($166,920.00).
3.1 Consultant shall maintain accounting records of its billings which includes
the name of the employee, type of work performed, times and dates of all work which is
billed on an hourly basis and all approved incidental expenses including testing
supplies.
3.2 Consultant shall submit monthly invoices to City payable by City within
thirty (30) days of receipt of invoice subject to the approval of City.
3.3 Consultant shall not receive any compensation for extra work without prior
written authorization of City.
3.4 City shall reimburse Consultant only for those costs or expenses which
have been specifically approved in this Agreement, or specifically approved in advance
by City. Such cost shall be limited and shall include nothing more than the following •
costs incurred by Consultant:
A. The actual costs of subconsultants for performance of any of the services
which Consultant agrees to render pursuant to this Agreement which have
been approved in advance by City and awarded in accordance with the
terms and conditions of this Agreement.
B. Approved computer data processing and reproduction charges.
C. Actual costs and /or other costs and /or payments specifically authorized in
advance in writing and incurred by Consultant in the performance of this
Agreement.
3.5 Notwithstanding any other paragraph or provision of this Agreement,
beginning on the effective date of this Agreement, City may withhold payment of ten
percent (10%) of each approved payment as approved retention until all services under
this Agreement have been substantially completed.
4. STANDARD OF CARE
4.1 All of the services shall be performed by Consultant or under Consultant's •
supervision. Consultant represents that it possesses the professional and technical
0 0
• personnel required to perform the services required by this Agreement, and that it will
perform all services in a manner commensurate with the university s professional
standards. All services shall be performed by qualified and experienced personnel who
are not employed by City nor have any contractual relationship with City. Consultant
represents and warrants to City that it has or shall obtain all licenses, permits,
qualifications and approvals required of its profession. Consultant further represents
and warrants that it shall keep in effect all such licenses, permits and other approvals
during the term of this Agreement.
4.2 Consultant shall not be responsible for delay, nor shall Consultant be
responsible for damages or be in default or deemed to be in default by reason of strikes,
lockouts, accidents, or acts of God, or the failure of City to furnish timely information or
to approve or disapprove Consultant's work promptly, or delay or faulty performance by
City, contractors, or governmental agencies, or any other delays beyond Consultant's
control or without Consultant's fault.
S. INDEPENDENT PARTIES
City retains Consultant on an independent contractor basis and Consultant is not
an employee of City. The manner and means of conducting the work are under the
control of Consultant, except to the extent they are limited by statute, rule or regulation
• and the expressed terms of this Agreement. Nothing in this Agreement shall be
deemed to constitute Consultant or any of Consultant's employees or agents, to be the
agents or employees of City. Consultant shall have the responsibility for and control
over the details in means of performing the work provided that Consultant is in
compliance with the terms of this Agreement. Anything in this Agreement which may
appear to give City the right to direct Consultant as to the details of the performance of
the services or to exercise a measure of control over Consultant shall mean that
Consultant shall follow the desires of City only with respect to the results of the services.
6. COOPERATION
Consultant agrees to work closely and cooperate fully with Dave Kiff, Assistant
City Manager, the City's designated Research Project administrator ("Project
Administrator"), and any other agencies which may have jurisdiction or interest in the
work to be performed. City agrees to cooperate with the Consultant on the Research
Project.
7. PROJECT MANAGER
Consultant shall assign responsibility for the Research Project to a Principal
• Investigator, who shall coordinate all phases of Consultant's efforts on the .Research
Project. The Principal Investigator shall be available to City at all reasonable times
during the Research Project term. Consultant has designated Dr. Sunny Jiang to be its
3
0 0
Principal Investigator. Consultant shall not bill any personnel to the Research Project
other than those personnel identified in Exhibit "B ", whether or not considered to be key •
personnel, without City's prior written approval by name and specific salary rate.
Consultant shall not remove or reassign the Principal Investigator designated in this
Section or assign any new or replacement Principal Investigator to the Research Project
without the prior written consent of City. City's approval shall not be unreasonably
withheld with respect to replacement of the Principal Investigator.
Consultant warrants that it will continuously furnish the necessary personnel to
complete the Research Project on a timely basis as contemplated by this Agreement.
8. TIME OF PERFORMANCE
Time is of the essence in the performance of the services under this Agreement
and the services shall be performed by Consultant in accordance with Exhibit A. The
failure by Consultant to strictly adhere to the schedule may result in termination of this
Agreement by City. Notwithstanding the foregoing, Consultant shall not be responsible
for delays which are due to causes beyond Consultant's reasonable control. However,
in the case of any such delay in the services to be provided for the Research Project,
each party hereby agrees to provide notice to the other party so that all delays can be
addressed.
8.1 Consultant shall submit all requests for extensions of time for performance •
in writing to the Project Administrator not later than ten (10) calendar days after the start
of the condition which purportedly causes a delay, and not later than the date upon
which performance is due. The Project Administrator shall review all such requests and
may grant reasonable time extensions for unforeseeable delays, which are beyond
Consultant's control.
8.2 For all time periods not specifically set forth herein, Consultant shall
respond in the most expedient and appropriate manner under the circumstances, by
either telephone, fax, e-mail, hand delivery or mail.
9. CITY POLICY
Consultant will discuss and review all matters relating to policy and project
direction with the Project Administrator in advance of all critical decision points in order
to ensure that the Research Project proceeds in a manner consistent with City goals
and policies.
40
0
i 10. CONFORMANCE TO APPLICABLE REQUIREMENT
All work prepared by Consultant shall conform to applicable city, county, state
and federal law, regulations and permit requirements and be subject to approval of the
Project Administrator and City.
11. PROGRESS
Consultant is responsible to keep the Project Administrator and /or his/her duly
authorized designee informed on a regular basis regarding the status and progress of
the work, activities performed and planned, and any meetings that have been scheduled
or are desired.
12. HOLD HARMLESS
Consultant shall indemnify, defend, save and hold harmless City, its City Council,
boards and commissions, officers and employees from and against any and all loss,
damages, liability, claims, allegations of liability, suits, costs and expenses for damages
of any nature whatsoever, including, but not limited to, bodily injury, death, personal
injury, property damages, or any other claims arising from any and all acts or omissions
•
of Consultant, its employees, agents or subcontractors in the performance of services or
work conducted or performed pursuant to this Agreement, but only in proportion to and to
the extent such loss, damages, liability, claims, allegations of liability, suits, costs and
expenses for damages are caused by or result from the negligent or intentional acts or
omissions of Consultant, its officers, agents, or employees.
E
City shall indemnify, defend, save and hold harmless Consultant, its trustees,
boards and commissions, officers and employees from and against any and all loss,
damages, liability, claims, allegations of liability, suits, costs and expenses for damages
of any nature whatsoever, including, but not limited to, bodily injury, death, personal
injury, property damages, or any other claims arising from any and all acts or omissions
of City, its employees, agents or subcontractors in the performance of services or work
conducted or performed pursuant to this Agreement, but only in proportion to and to the
extent such loss, damages, liability, claims, allegations of liability, suits, costs and
expenses for damages are caused by or result from the negligent or intentional acts or
omissions of City, its officers, agents, or employees.
Nothing in this indemnity shall be construed as authorizing, any award of attomeys' fees
in any action on or to enforce the terms of this Agreement.
5
0
13. INSURANCE
•
Without limiting consultant's indemnification of City, and prior to commencement
of work, Consultant shall obtain and provide and maintain at its own expense during the
term of this Agreement self - insurance or policy or policies of liability insurance of the
type and amounts described below and satisfactory to City. Certification of all required
policies shall be signed by a person authorized by that insurer to bind coverage on its
behalf and must be filed with City prior to exercising any right or performing any work
pursuant to this Agreement. Except workers compensation, all insurance policies shall
add City, its elected officials, officers, agents, representatives and employees as
additional insured for all liability arising from Consultant's services as described herein.
All insurance policies shall be issued by an insurance company currently
authorized by the Insurance Commissioner to transact business of insurance in the
State of California, with an assigned policyholders' Rating of A (or higher) and Financial
Size Category Class VII (or larger) in accordance with the latest edition of Bests Key
Rating Guide: unless otherwise approved by the City Risk Manager.
A. Worker's compensation insurance covering all employees and principals
of Consultant, per the laws of the State of California.
•
B. Commercial general liability insurance covering third party liability risks,
including without limitation, contractual liability, in a minimum amount of $1 •
million combined single limit per occurrence for bodily injury, personal
injury and property damage. If commercial general liability insurance or
other form with a general aggregate is used, either the general aggregate
shall apply separately to this Research Project, or the general aggregate
limit shall be twice the occurrence limit.
C. Commercial auto liability and property insurance covering any owned and
rented vehicles of Consultant in a minimum amount of $1 million combined
single limit per accident for bodily injury and property damage.
Said policy or policies shall be endorsed to state that coverage shall not be
canceled by either party, except after thirty (30) days' prior notice has been given. in
writing to City. Consultant shall give City prompt and timely notice of claim made or suit
instituted arising out of Consultant's operation hereunder. Consultant shall also procure
and maintain, at its own cost and expense, any additional kinds of insurance, which in
its own judgment may be necessary for its proper protection and prosecution of the
work.
Consultant agrees that, in the event of loss due to any of the perils for which it
has agreed to provide comprehensive general and automotive liability insurance,
Consultant shall look solely to its insurance for recovery. Consultant hereby grants to
City, on behalf of any insurer providing comprehensive general and automotive liability •
insurance to either Consultant or City with respect to the services of Consultant herein,
M
0
L]
a waiver of any right of subrogation which any such insurer of said Consultant may
acquire against City by virtue of the payment of any loss under such insurance.
14. PROHIBITION AGAINST TRANSFERS
Consultant shall not assign, sublease, hypothecate or transfer this Agreement or
any for the services to be performed under this Agreement, directly or indirectly, by
operation of law or otherwise without prior written consent of City. Any attempt to do so
without consent of City shall be null and void.
15. OWNERSHIP OF DOCUMENTS
Each and every report, draft, work product, map, record and other document
reproduced, prepared or caused to be prepared by Consultant pursuant to or in
connection with this Agreement and delivered to City shall be the exclusive property of
City.
Documents, including drawings and specifications, prepared by Consultant
pursuant to this Agreement are not intended or represented to be suitable for reuse by
City or others on any other project. Any use of completed documents for other projects
• and any use of incomplete documents without specific written authorization from
Consultant will be at City's sole risk and without liability to Consultant. Further, any and
all liability arising out of changes made to Consultant's deliverables under this
Agreement by City or persons other than Consultant is waived against Consultant and
City assumes full responsibility for such changes unless City has given Consultant prior
notice and has received from Consultant written consent for such changes.
Consultant shall, at such time and in such form as City may require, furnish
reports concerning the status of services required under this Agreement.
16. CONFIDENTIALITY
Because the City deems the Scope of Services outlined in Attachment A to be of
benefit to a wide variety of constituencies, the City and its Consultant apply no specific
confidentiality limitations on any information which results from the services in this
Agreement. Both parties reserve the right to retain any information as confidential if
agreed to by both parties.
17. ADMINISTRATION
This Agreement will be administered by the City Managers Department. Dave
• Kiff, Assistant City Manager, shall be considered the Project Administrator and shall
have the authority to act for City under this Agreement. The Assistant City Manager or
0 9
his authorized representative shall represent City in all matters pertaining to the
services to be rendered pursuant to this Agreement. •
18. RECORDS
Consultant shall keep records and invoices in connection with the work to be
performed under this Agreement. Consultant shall maintain complete and accurate
records with respect to the costs incurred under this Agreement. All such records shall
be clearly identifiable. Consultant shall allow a representative of City to examine, audit
and make transcripts or copies of such records during normal business hours.
Consultant shall allow inspection of all work, data, documents, proceedings and
activities related to the Agreement for a period of three (3) years from the date of final
payment under this Agreement.
19. WITHHOLDINGS
City may withhold payment of any disputed sums until satisfaction of the dispute
with respect to such payment. Such withholding shall not be deemed to constitute a
failure to pay according to the terms of this Agreement. Consultant shall not discontinue
work as a result of such withholding. Consultant shall have an immediate right to
appeal to the City Manager or his designee with respect to such disputed sums.
Consultant shall be entitled to receive interest on any withheld sums at the rate of seven •
percent (7 %) per annum from the date of withholding of any amounts found to have
been improperly withheld.
20. CITY'S RIGHT TO EMPLOY OTHER CONSULTANTS
City reserves the right to employ other consultants in connection with the
Research Project.
21. CONFLICTS OF INTEREST
A. The Consultant or its employees may be subject to the provisions of the
California Political Reform Act of 1974 (the "Act "), which (1) requires such
persons to disclose financial interest that may foreseeably be materially
affected by the work performed under this Agreement, and (2) prohibits
such persons from making, or participating in making decisions that will
foreseeably financially affect such interest.
B. If subject to the Act, Consultant shall conform to all requirements of the
Act. Failure to do so constitutes a material breach and is grounds for
termination of this Agreement by City. Consultant shall indemnify and 40
• •
• hold harmless City for any and all claims for damages resulting from
Consultants violation of this Section.
22. SUBCONSULTANT AND ASSIGNMENT
Except as specifically authorized under this Agreement, the services included in
this Agreement shall not be assigned, transferred, contracted or subcontracted without
prior written approval of City.
23. NOTICES
All notices, demands, requests or approvals to be given under this Agreement
shall be given in writing and conclusively shall be deemed served when delivered
personally or on the third business day after the deposit thereof in the United States
mail, postage prepaid, first class mail, addressed as hereinafter provided.
All notices, demands, requests or approvals from Consultant to City shall be
addressed to City at:
City of Newport Beach
• City Manager's Office
3300 Newport Boulevard
P. O. Box 1768
Newport Beach, CA, 92658 -8915
949/644 -3002 (phone)
949/644 -3020 (fax)
All notices, demands, requests or approvals from City to Consultant shall be
addressed to Consultant at:
Attention: Doug Bickham
Contracts Officer
Sponsored Projects Administration
University of California, Irvine
160 Administration Building
Irvine, CA 92697- 1875
(949) 824- 2644 (phone)
(949) 824- 2094 (fax)
24. TERMINATION
• In the event either party hereto fails or refuses to perform any of the provisions
hereof at the time and in the manner required hereunder, that party shall be deemed in
default in the performance of this Agreement. If such default is not cured within a period
of two (2) days, or if more than two (2) days are reasonably required to cure the default •
and the defaulting party fails to give adequate assurance of due performance within two
(2) days after receipt of written notice of default, specifying the nature of such default
and the steps necessary to cure such default, the nondefaulting parry may terminate the
Agreement forthwith by giving to the defaulting party written notice thereof.
City or Consultant shall have the option, at its sole discretion and without cause,
of terminating this Agreement by giving seven (7) days' prior written notice to the other
party as provided herein. Upon termination of this Agreement, City shall pay to the
Consultant that portion of compensation specified in this Agreement that is earned and
unpaid prior to the effective date of termination.
25. COMPLIANCES
Consultant shall comply with all laws, state or federal and all ordinances, rules
and regulations enacted or issued by City.
26. WAIVER
A waiver by either party of any breach, of any term, covenant or condition
contained herein shall not be deemed to be a waiver of any subsequent breach of the •
same or any other term, covenant or condition contained herein, whether of the same or
a different character.
27. INTEGRATED CONTRACT
This Agreement represents the full and complete understanding of every kind or
nature whatsoever between the Parties hereto, and all preliminary negotiations and
agreements of whatsoever kind or nature are merged herein. No verbal agreement or
implied covenant shall be held to vary the provisions herein. Any modification of this
Agreement will be effective only by written execution signed by both City and
Consultant.
IN WITNESS WHEREOF, the Parties have caused this Agreement to be
executed on the day and year first written above.
•
10
I
• APPROVED AS TO FORM:
Robert Burnham
City Attorney
for the City of Newport Beach
ATTEST:
By:
LaVonne Harkless
City Clerk
•
40
CITY OF NEWPORT BEACH
A Municipal Corporation
By:
Tod W. Ridgeway
Mayor
for the City of Newport Beach
CONSULTANT
0
The Regents of
the University of California
11
Sunny Jiang •
• 05/24/2002
Scope of Work •
Determining the Relationships Between Fecal Indicators
and Human Pathogenic Viruses in Newport Bay Watershed
Phase II
Background and Objectives:
The microbial quality of water is a prime public health concern in today's world. It is
estimated that the risk of becoming ill as a result of microbial contamination of food and water is
100,000 times greater than the risk from pesticide contamination (WHO 1993). To protect public
health, the World Health Organization and the U.S. Environmental Protection Agency have
established microbial pollution indicator standards and recommended routine monitoring of
water for fecal bacterial indicators (Dufour, 1984, U.S. EPA 1986,1994, WHO 1993).
Coastal recreational water quality standards in California, and throughout most of the
world, are based on the concentration of total coliform, fecal coliform, and enterococcus groups
of indicator bacteria (Bartram and Rees 2000). However, the adequacy of current water quality
standards to indicate the presence or absence of human pathogens is still questionable. For
example, human viruses are more resistant to sewage treatment processes and environmental
conditions than bacterial indicators and therefore may pose a substantial threat. It is now
recognized that the absence, or a low concentration, of indicator organisms in water may not
adequately reflect the absence of human viruses. Waterborne infectious viruses are suspected to •
be more important than current knowledge suggests because viral diseases are hard to identify by
current diagnostic techniques. While the causative agent of nearly 50% of all acute
gastrointestinal illnesses cannot be identified (Center for Disease Control, 1988, 1990, 1991,
1993) most of these illnesses are suspected to be caused by viruses. Therefore, viral quality of
recreational coastal water is of particular importance and a rising public health concern.
Newport Bay, California is an important estuarine system in Southern California.
Tourists worldwide visit this area for boating, kayaking, sailing, swimming and other water
recreational activities. To protect public health and the beneficial use of this valuable resource,
the State Water Quality Control Board requires strategies to be developed and stepwise
implemented to improve Newport Bay water quality to meet recreational standards (REC -1) by
the year 2014. With the goal of understanding the relationship between fecal indicator bacterial
concentrations and human pathogenic viral loads in this watershed, the specific objectives of this
study are the following:
1. To statistically determine the relationships between enteric viruses and fecal indicators
(total coliform, fecal coliform, enterococcus and F- coliphage) in the watershed;
2. To determine the presence and distribution of F- specific coliphage and enteric viruses in
various locations in Newport Bay and its tributaries using culture enrichment and
polymerise chain reaction (PCR) analysis, respectively;
3. To investigate the viral infectivity by combining PCR with tissue culture analysis
(integrated PCR tissue culture assay).
u
Sunny Jiang • • 05/24/2002
• Project Approach
Results from the phase I & 11 Newport Bay water quality investigation conducted during
the summer of 2000 and 2001 indicated that the occurrence of enteroviruses did not statistically
correlate with the abundance of total coliform, fecal coliform and enterococcus. However, in all
cases when there was a presence of enterovirus, the enterococcus number was always greater
than the current AB411 standards (100 CFU /100ml). Only a few locations around the Bay were
sampled repetitively to produce a statistically valid analysis of the relationship between viruses
and indicators. This proposed study will expand sampling locations and frequencies for human
viral testing, guided by a desired statistical sensitivity and power. In addition, more than one
virus will be included in our detection effort because the presence of viral contamination in the
watershed may shift with the human disease load and the populations harboring the disease
(either symptomatic or asympotomatic) in a local community.
Sampling Plans
The proposed sampling locations and frequencies are listed in Table 1. A total of 15
locations around the Newport Bay will be sampled 8 times between May 22, 2002 and
September 24, 2002.
Three to five liters of water samples will be collected from each site and split for
detection of fecal bacterial indicators, enteric viruses and coliphage. Table 1. shows the proposed
• sampling schedule and parameters that will be determined at each location. All water samples for
viral testing will be collected between 6 to 9 am in the morning and processed within 4 -6 hours
of collection. Simultaneously, the temperature and salinity of the water will also be measured in
situ to provide background information on basic environmental conditions. The tidal cycles will
be noted at the stage of data analysis. All data collected will be logged into a database on the
same day of the sample collection.
Detection of Enteric Viruses
A minimum of 500m1 of water from each site will be concentrated using a Centriplus
ultrafiltration system (Millipore Inc.) to a final volume of —500 µl. This 1000 fold concentration
factor will allow detection of viruses at a concentration greater than 200 genomes per liter of
water. The final concentrates will be slit and stored frozen until analyzed by PCR and tissue
culture.
Viral nucleic acid extraction and purification will follow the method originally developed
by Boom et al. (1990) with minor modifications. This method uses guanidinium thiocyanate
(GuSCN) with Triton X -100 to lyse viral particles and silica beads to absorb nucleic acid,
allowing effective purification of DNA and RNA at the same time. In brief, 50 µl of viral
concentrate are lysed by 900 µl of GuSCN lysis buffer at room temperature for 10 min. Then 40
µl of silica particles are added and nucleic acids absorbed at room temperature for 10 min with
gentle shaking. Silica beads are pelleted, washed and dried. The nucleic acid will is then eluted
from the beads using 50 µl TE buffer at a temperature of 56 °C. The purified nucleic acid will be
• used for detection of human viruses by PCR or RT -PCR as described below. This method has
been shown to be effective at purification of viral nucleic acid from seawater concentrates, river
`I
Sunny Jiang • • 05/24/2002
water and sewage effluent. Alternatively, we will use commercial RNA and DNA purification kit •
for extraction.
Primers for specific amplification of the target viral genomes are shown in Table 2. The
procedure for RT -PCR of enterovirus will follow the protocol developed by Tsai et al. (1993)
with a modification of the total reaction volume. Amplification products will be further
confirmed by probing with internal oligonucleotide probes after southern transfer of DNA.
Probing will also increase the detection limit of the PCR amplification product. For adenovirus
detection, a nested PCR protocol will be used as previously described by Pina et al. (1998). This
procedure has been successfully used in my laboratory for detection of viruses in coastal waters.
Determine the Viral Infectivity by Integrated Cell Culture PCR
To compare viral infectivity with PCR results, the frozen concentrate will be used for
integrated cell culture PCR as described by Ballaster et al. (2000). This portion of the study will
be conducted during the second year of the project once initial PCR screening has been
completed. Final results from these analyses will be integrated with the results on the presence of
human viruses by direct PCR, standard fecal indicators, coliphage and basic environmental
parameters.
Quantification of F- specific Coliphage by Culture Enrichment
Five -tube enrichment will be used to determine the most probable number (MPN) of the
phage. For MPN determination, five 100 -m1 water samples from each site were amended with 5
ml sterile I 1 x TSB medium, 1 ml E. coli host and antibiotics. Negative controls will contain five •
tubes of 100-ml sterile DI water amended with nutrient medium, E. coli host and antibiotic as in
regular sample assay. The enrichment cultures will be incubated at 37 °C for 24 hours before spot
testing for the presence of F- specific coliphage.
For replicate spot testing, 1 ml of log phase E. coli host will be mixed with top agar and
overlayed onto TSB agar plates containing antibiotics to form an even bacterial lawn. Two
microliters of each enrichment culture was spotted onto the freshly prepared bacterial lawn.
Plates are incubated at 37 °C for 8 to 16 hours. Clearing spots are scored and the MPN calculated
using Thomas' formula (Clesceri et al. 1998).
Statistical Analysis to Determine the Relationship Between Human Viruses and Fecal
Indicators
Statistical analysis of the entire data set will be performed during the second project year when
all tests for all samples are completed. Both linear regression analysis and multiple regression
analysis will be conducted using the data set. The concentration of fecal indicators, human
viruses and coliphage may be natural log transformed to achieve normal distribution. Human
viruses will be used as the dependent variable and all other measured factors will be used as
independent variables in the linear regression analysis. The relationship between independent
variables will be examined by analysis of variance (ANOVA) to ruleout of the possibility of
covariance. Other statistical analysis may also be used if considered necessary when data •
3
Sunny Jiang • 05/24/2002
• becomes available. All statistical analyses will be performed using the SAS or SPSS software
packages (SPSS Inc. Chicago, IL).
Table 1. Sampling Sites and Schedule for Summer 2002 Study
Sampling Sites
Fecal indicator bacteria 'hot spots'
1 Santa Ana Delhi Channel at Mesa
2 Santa Ana Delhi Channel at University
3 San Diego Creek at Campus
4 Lower Newport Bay at 43rd Street
5 Big Canyon Wash
High recreational use sites
6 North Star Beach
7 Newport Dunes North (@Bridge)
8 Newport Dunes Inside Roped Swimming Area
9 Bayshores Beach
10 Balboa Yacht Basin
11 10th Strett Beach or 19th Street Beach
12 Garnet Avenue Beach (on Balboa Island)
13 Harbor Patrol Beach
• 14 Rocky Point Beach
15 Newport Dunes Outside Roped Swimming Area
Sampling Dates
May 22, 2002
May 28, 2002
June 10, 2002
July 6, 2002
July 22, 2002
August 7, 2002
September 3, 2002
September 22, 2002
Assay to be performed on each sample
Environmental Parameters
Temperature
Salinity .
Conductivity
Fecal Indicators
• Total coliform, Fecal coliform, Enterococcus
F- specific coliphage- enrichment
Total 15 samples per day
Special Notes
First Day after Memorial Day
Saturday- During July 4th long weekend
First Day after labor day weekend
Sunday
Total 8 times per summer
2
Sunny Jiang • 9 05/24/2002
Enteric viruses by PCR •
viruses Infectivity assay
Total number of samples 120
Note: Dr. Jiang may perform adenovirus detection tests using the same samples.
Table 2. PCR primers and probes for virus detection
Target Primer and probe sequences Amplicon and
viruses target
Pan- Upstream, 5'- CCTCCGGCCCTGAATG -3' 197 -bp highly
enterovirus Downstream, 5'- ACCGGATGGCCAATC -3' conserved 5'
Probe, 5'- TACTTTGGGTGTCCGTGTTTC -3' untranslated
region.
Adenovirus First upstream, 5'- GCCGCAGTGGTCTTACATGCACATC -3' 301 -bp Hexon •
First downstream, 5'- CAGCACGCCGCGGATGTCAAAGT -3'
Nested upstream ,5' - GCCACCGAGACGTACTTCAGCCTG -3' 143 -bp Hexon
Nested downstream 5'-
TTGTACGAGTACGCGGTATCCTCGCGGTC-3'
5
L�
Budget Justification for " &rmining the relationship betweer0cal indicators and
human pathogenic viruses in Newport Bay Watersbed ".
• A. PERSONNEL
PI: Sunny Jiang will be in charge of the research work done on the Newport Bay
Project, located in the Newport Bay waters. She will devote 10% of her time during the
academic school year and summer to direct the sampling plan, sample analysis and
preparation of the final report. All salaries and wages were estimated using UCI's
academic and staff salary scales.
Postgraduate Researcher to be announced at a later date will be helping Dr. Jiang in
conducting her research and collecting samples of water from Newport Bay. He /She will
analyze the samples for the occurrence of human viruses by PCR and tissue cultures on
this project. The Postgraduate Researcher will devote 100% of its time during the
academic school year and summer.
Lab Assistant to be announced at a later date will help Dr. Jiang and the Post -Doc on
analyzing the samples collected for the presence of F- specific coliphage and other
environmental parameters. This person will work at a rate of 25% during the fiscal year.
Anticipated cost of living increases effective 10/01/02 are 2% for academic personnel
and staff. The fringe benefits are calculated at the composite rate of 17% for
Professor's and Post Graduate Researcher's during the academic school year. Lab
• Assistant's fringe benefit rate is calculated at the composite rate of 5.2 %.
B. SUPPLIES
Material and Supplies the cost will cover particular materials and supplies such as;
molecular reagents, enzymes, microbiological media, tissue culture supplies and media,
disposable plastic ware, nylon membrane, automatic pipettes, and glassware. All costs are
based on previously purchased and presently used chemicals, reagents and supplies and on
catalogue prices.
C. Publication
Publication cost will cover any materials or supplies etc., that go along with publishing
information on the results founded during the research of microbial contamination of
food and water.
D. Facilities and Administrative
In accordance with the City of Newport Beach policy on research contracts, the indirect
costs have been limited to 15% on this proposal.
•
0
Detailed Budget Outline
0
Cost Category items
Period
5/01/024/30/04
Salaries and Wages
PI: Sunny Jiang, Ph.D. - ] 0% MOS 24
$
11,092
TBN, Postdoc PGR II - 100% Mos 24
$
68,944
TBN, Lab assistant II, Step 1 - 25% Mos 24
$
9,988
Subtotoal Salaries
$
90,024
Fringe Benefits
PI: Sunny Jiang -17%
TBN, Postdoc PGR II -17%
TBN, Lab Assistant II, Step 1 -5.2%
Subtotal Fringe Benefits
$
$
$
$
1,885
11,720
519
14,124
Total salary and Benefits
$
104,148
Non-expendable Equipment Items
N/A
MateriaWSupplies
$
40,000
Travel
N/A
Computing
N/A
Other Costs/Publication Costs
$
1,000
Total Direct Costs
$
145,148
Facilities and Administration Rate (overhead)
15.00%' 145,145 = 21,772
$
21,772
TOTAL COSTS
$
166,920
Cost per Sample Direct Cost
112 Samples each@ 1296
indirect
$194
$
Total Per
Sample Cost
1,490
•
•